INTRODUCTION:

Mushroom has been introduced as an important food supplement in human diet for many years. Many scientific works have been conducted to characterize various aspects of mushroom.

It was already established that he antioxidant activity of edible mushroom assists on the adverse effect of reactive oxygen species¹. The mode of action of antimicrobial substances of mushroom was already reported². The beneficial biological activities of various chemical compounds isolated from Agaricus bisporus were well elucidated³.

A search of actinomycetes producing newer metabolites for antifungals against Candida albicans was inspected and reported⁴. The of antimicrobial potentiality and detoxification ability of Pleurotus ostreatus on the fungus Fusarium sporotrichioides were well studied⁵. Experiments to identify a rich producer of omega-3 fatty acid from various filamentous fungi were conducted⁶. The medicinal property of protein extracted from Oyster and button mushroom were investigated⁷. The extracts of Agaricus bisporus, famous as a source of many important chemicals had been proved to be protective role against several other pathogenic microbes⁸.

In spite of various reports and investigations, the genetic information regarding lower plants is very insufficient. Various groups of scientists are working to improve the DNA database of fungi.

The isolates of Trichoderma spp. from Pleurotus ostreatus and P. eryngii beds were collected and the occurrence of different species of Trichoderma as T. cf. virens (70.8%), T. longibrachiatum (16.7%) and T. harzianum (12.5%) was narrated⁹. The RAPD analysis detected variability amongst three different species of Trichoderma using two URP-primers. As differentiation of commercial cultivated strains of Auricularia mushrooms were difficult due to the lack of useful distinct characters, the RAPD technique was adopted to characterize the genetic diversity to select 11 commercial strains of A. auricula and five commercial strains of A. polytricha and one white-fruit body mutant strain¹⁰. The ability and benefit of RAPD in finger printing on traditional medicinal plants was narrated¹¹. The Brazilian and Chinese strains of Ganoderma lucidum were analyzed with molecular RAPD markers¹². A similarity matrix was drawn and the RAPD profiles of G. lucidum strains were also compared to two other Ganoderma spp: G. applanatum and G. lipsiense to produce genetic relationship among the species. The phylogenetic relationship among the eleven edible (A. bisporus, A. bisporus, P. eryngii, L. edodes, H. tessellatus, H. tessellatus, F. velutipes, P. ostreatus, P. djamor, C. indica, and P. florida) mushrooms using RAPD markers was focused on established¹³. Seven strains of (Pleurotus) Oyster mushroom (two local and five exotic) were analyzed to detect their genetic diversity through RAPD markers¹⁴.

The pattern and mechanism of ITS sequence heterogeneity within Agaricus subrufescens was investigated¹⁵. The phylogenetic relation of the mushroom of the genus Pleurotus in western China was thoroughly analysed¹⁶. Its taxonomical position was unclear and the nuc rDNA internal transcribed spacers (ITS) was analysed for the experiment. The verification of species was conducted with the analysis of ITS to identity for processed raw materials, as processing removes morphological characteristics, this was being very difficult for samples containing fungal mycelia¹⁷.

In recent years the isolates of specieses Trichoderma from sugarcane were elucidated for their phylogenetic relationship using Internal Transcribed Study (ITS) of rDNA¹⁸.

MATERIAL AND METHOD:

Spawns of four different gilled mushroom spawn were collected namely, Lentinus edodes (Le), Calocybe indica (Ci), Pleurotus flabellatus (Pf) and Hypsyzygus ulmarius (Hu) from Gaia Biotech in Kolkata. Fungal culture was grown in PDB (Potato Dextrose broth) with the spawn maintaining sterile situation and incubated at 30⁰C, on a shaker at room temperature (37⁰C). Seven to eight days old vegetative mycelia was used for DNA isolation for RAPD and ITS study.

Sample preparation:

The colony-entangled mass of hyphae were collected from the culture media, blotted on filter paper and weighed. 200mg of fungal mycelia were disrupted in liquid nitrogen to a fine powder and the DNA was isolated using HiPurA™ Fungal DNA Purification Kit with few modifications. 1% Agarose gel electrophoresis was done to reveal the purity of the genomic DNA. To get accurate DNA quantization, 2µL of sample was assessed using Thermo Scientific™ NanoDrop™ spectrophotometers.

The aforesaid DNA samples were used for RAPD and Internal Transcribed Study (ITS).

PCR for RAPD study:

Isolated DNA samples of the four varieties were used for RAPD reaction. Eighteen different primers were designed from SIGMA-ALDRICH Chemical Pvt. Ltd (Bangalore) to amplify DNA of these four species.

Primer Selection For RAPD:

Lyophilized primers were dissolved to obtain 200uM stock and the stock primer solutions were diluted to 10 um by adding 5ul of stock solution to 95ul sterile distilled water and used for RAPD.

PCR Conditions of RAPD:

The amplification was performed in a final volume of 25 μL containing 2.5μL of 10 x PCR reaction buffer (Promega, USA) and 200μM of each dNTP (Promega, USA) with different primers pmol per reaction), MgCl₂ (2.8mM), template DNA (25ng) and Taq DNA polymerase (2.5U per 25μL reaction solution) (Promega, USA). In a thermocycler (Applied Biosystems PCR thermal cyclers USA) the reactions were submitted to the following amplification profile: initial denaturation step at 94⁰C for five min, followed by 35 repetitions of forty five seconds at 94⁰C, forty-five seconds at 26⁰C and two min at 72⁰C. In the final cycle, the extension step was 10 min at 72⁰C.

The PCR products were analyzed by electrophoresis in 1.8% agarose gel in 1XTE buffer and subsequent staining with ethidium bromide (0.5mg/mL) with visualization using a BioRad.

Primer design For ITS:

Conserved primers¹⁹ for study of internal transcribed spacer studies were custom designed from 1st BASE PVT LTD, Singapore. Primers were supplied as lyophilized condition and they were made to 100µM solution by addition of sterilized triple dH₂O in an aseptic condition as prescribed in oligonucleotide data sheet supplied with the primer. In a laminar airflow chamber, sterilized triple dH₂O was added to the primer by sterilized micropipette tip and one primer was handled at a time. After addition of water, the vial was tapped and kept aside at room temperature for 20 min, after which all the vials were subjected to pulse spin to bring the solution down. The primers were stored at – 80⁰C for long-term storage. The details of primers are given in table 1.

Table 1: Primer sequence of ITS1 and ITS2

Name	Sequence	Tm	GC %	Length
ITS1 Forward	5′- TCCGTAGGTGAACCTGCGG -3′	68.5⁰ C	63.1	19 mer
ITS4-Reverse	5′- TCCTCCGCTTATTGATATGC -3′	61.5⁰ C	45.0	20 mer

PCR Conditions of ITS:

PCR reaction was set with 25µl of reaction mixture containing 10XPCR Buffer, 1mM each of dATP, dTTP, dGTP, dCTP, 5mM Genespecific primer (each of forward and reverse primer set at a thermal cycle suitable to amplify rRNA gene following amplification profile: initial denaturation step at 94⁰C for four min, followed by 35 repetitions of one minute at 94⁰C, forty-five seconds at 58⁰C and one min at 72⁰C. In the final cycle, the extension step was 10min at 72⁰C.), 10ng of genomic DNA, 4mM MgCl₂and 2unit of Taq polymerase were taken in a PCR tube (0.2ml).

PCR machine (GeneAmp® PCR system 2700, Applied Biosystems, Singapore) was used for amplification.

Data interpretation and Analysis:

RAPD Study:

Different primer pair produced different banding pattern depending upon the sequences and genomic DNA samples used for PCR reaction. Details of bands are given in table 2.

Visible and scorable bands were counted (1 for the presence and 0 for the absence of a band on a specific position) across the lanes for each of primer combinations in the autoradiogram. The data were then transferred to binary matrix for the analysis using the Software Package Python (version: 3). Jaccard’s coefficient (Proximity matrix) was used to calculate the similarity among the four varieties (Table: 3). Cluster analysis was performed by the proximity matrix using the complete linkages and a dendrogram was generated (Fig: 1).

Table 2: Name of primer and Details of bands produced by primers

Sl No.	Primer	Number of total bands/Primer	Number of unique bands
1	OPA 8	14	4
2	OPD 20	14	3
3	OPR 09	22	9
4	OPS 05	18	7
5	OPT 05	17	2
6	OPU 10	16	4
7	OPV 01	19	4
8	OPW 02	23	4
9	OPX 06	16	3
10	OPZ 10	23	5
11	OPA 02	23	6
12	OPA 04	16	0
13	OPR 12	6	2
14	OPN 16	8	4
15	OPM 14	7	5
16	OPA 20	16	5
17	OPK 01	22	6
18	OPI 02	14	4

ITS Study:

The sequencing Chromatograms were observed operating Chromas software Version 2.33 (www.technelysium.com.au by Technelysium Pty Ltd). The data were investigated combining and comparing both forward and reverse sequencing results. The reverse sequence was converted to its complementary sequence using ReadSeq at Sequence Manipulation Suite Programme and both sequences were then equated by NCBI Blast2 Blast to get complete sequence. The final forward and reverse complementary sequences were investigated by Bioinformatics tool BLAST 2 SEQUENCES (bl2seq) by Tatusova et al. 1999). This tool provides information regarding sequence match between two sequence inputs given by BLAST engine for local alignment. The homology of the sequences with other reported ITS sequences in the data base were explored operating Basic Local Alignment Tool (BLAST), by the algorithm delivered by National Centre for Biotechnological Information (NCBI) with software programme BLASTN 2.2.16²⁰ and the final ITS sequences were processed and submitted to Gene data bank.

RESULT:

RADP Study revealed that the isolated DNA of these four varieties presented clear genomic DNA band in 1.8% agarose gel electrophoresis. A total eighteen primer were screened in RAPD reaction and they produced high frequency of polymorphic bands. Among 18 primers used, all the primers did not show similar binding efficiency with DNA samples. The proximity matrix (Table: 3) was prepared following Jaccard’s coefficient and a dendrogram was generated (Fig: 1) by using the complete linkages Cluster analysis.

Table: 3 Jaccard’s coefficient (Proximity matrix)

	*Lentinula edodes*	*Calocyde indica*	*Pleurotus flabellatus*	*Hypsizygus ulmarius*
Lentinula edodes	1	0.104	0.096774194	0.165217391
Calocyde indica	0.104	1	0.904761905	0.161764706
Pleurotus flabellatus	0.096774194	0.904761905	1	0.155555556
Hypsizygus ulmarius	0.165217391	0.161764706	0.155555556	1

Table: 4 Number of Unique Molecular Marker Fragment Specific for Each Species under study

Sl number	Primer	Number of Unique molecular marker fragments specific for each variety				Total no of unique markers
Sl number	Primer	*Lentinus edodes* (Le)	*Calocybe indica* (Ci)	*Pleurotus* flabellatus (Pf)	*Hypsyzygus ulmarius* (Hu)	Total no of unique markers
1	OPA 8	0	0	0	4	4
2	OPD 20	0	0	0	3	3
3	OPR 09	1	1	3	4	9
4	OPS 05	4	1	0	2	7
5	OPT 05	2	0	0	0	2
6	OPU 10	2	0	0	2	4
7	OPV 01	3	0	0	1	4
8	OPW 02	2	0	0	2	4
9	OPX 06	2	0	0	1	3
10	OPZ 10	1	0	0	4	5
11	OPA 02	3	0	0	3	6
12	OPA 04	0	0	0	0	0
13	OPR 12	1	0	0	1	2
14	OPN 16	1	0	0	3	4
15	OPM 14	1	0	0	4	5
16	OPA 20	4	0	0	1	5
17	OPK 01	1	0	0	5	6
18	OPI 02	0	1	0	3	4

Fig: 1 Dendogram of RAPD study following Cluster analysis

Fig: 2 Graphical Phylogenetic Tree of ITS

Fig: 3 Gel electrophoresis of ITS

The primer pairs binding to different samples of DNA are given in the table (Table: 4).

Banding pattern and number of bands varied amongst the varieties and with the primer used. Most promising and best bandings were obtained with primers OPW 02, OPZ 10, OPA 02, producing maximum number of amplified products. A total number of 294 amplified fragments were found in all four varieties.

In the ITS that lacks coding region, the amplified ITS1 and ITS2 regions in DNA of four different varieties of mushrooms that were amplified with gene specific primers were purified, electrophoresed (Fig: 2) and sequenced for assaying the genetic diversity among these cultivars.

The maximum length of the ITS regions is obtained from Hypsyzygus ulmarius and smallest is obtained from Pleurotus flabellatus (Table 5).

Table: 5 The length of ITS Regions


Variety	ITS 1 and ITS 2 regions including 5.8s region
Lentinus edodes (Le),	609 bp
Calocybe indica (Ci),	615 bp
Pleurotus flabellatus (Pf)	576 bp
Hypsyzygus ulmarius (Hu)	671 bp

The amplified products were sequenced and the sequences were submitted to gene bank (Table: 6).

Table 6: Gene bank Accession number of Specimen

Specimen	Accession Number
Lentinus edodes (Le)	MF459665
Calocybe indica (Ci):	MF459666
Pleurotus flabellatus(Pf):	MF459667
Hypsyzygus ulmarius(Hu)	MF459668

The sequences were analyzed using homology-modeling system through NCBI-BLAST tool, which showed high level of sequence similarity with ITS regions of other Mushrooms.

The ITS regions of the five varieties were compared using Phylogenetic tree prediction. The ClustalW analysis, distance matrix (Table: 7) analysis and the phylogenetic tree (Fig: 2) were carried out.

CLUSTALW(1.2.4) multiple sequence alignment:

http://www.ebi.ac.uk/Tools/services/web/toolresult.ebi?jobId=clustalo-I20170713-085918-0879-53297645-oyandanalysis=phylotree

(Pleurotus AGGGGCCGGCATCTACTGATCGAGGTCACCTGGAAAAGATTGATTTGCGTTCGGCAAGC

(Lentinula ----------------------------------------------

(Calocybe –GCCGGGAAACGCGGGGAGGTGGGCGCGCCGGAACCCTACACTCGGAATGCTTCCGTA

(Hypsizygus ------------------------------ATTCATTAATAAATCCTTCTTCCCGTAAG

(Pleurotus GCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGG----ATCGGACG

(Lentinula --------------------GGGGCCTCTGGTT

(Calocybe GGTGAACCTGCGGAAGGATCATTACCGAGTGTAG--------------------

(Hypsizygus GGTGAACCTGCGGAAGGATCATTAATGAATTCACTATGGAGTTGTTGCTGGCCTCTAGGG

(Pleurotus CGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACG----

(Lentinula A

GCGCCTTACCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAA

(Calocybe

GGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTA--CCTTAGT

(Hypsizygus GCATGTGCACGCTTCACTAGTCTTTCAACCACCTGTGAACTTTTGATAGA-TCTGTGAA

* * * *

(Pleurotus –

ACCCAACACACAAGCCGTGCTTGATGGGCAGCAATGACGCTCGGACA-GGCA

(Lentinula AATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCT---ATCTGGGGTTTGATCGA

(Calocybe TGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCT-CAGCCCCGGGC---CCGC

(Hypsizygus GTCGTCTTTCAAGTCGTCAGACTTGGTTTGCTGGGATTTAAACGTCTCGGTGTGACAAC

** * * **

(Pleurotus TGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACGGAAT

(Lentinula TGCCACTCCTGGTTTCAGGA-------GTACCCTTCATAATAAACCTAGAAATTCAGTA

(Calocybe GCCC------GCCGGAGACACCACGAACTCTGTCTGA----TCTAGTGAAGTCTGAGTT

(Hypsizygus GCAGTCTATTTACTTAACACACCCCAAATGTATGTCTACGAATGTCATTTAATGGGCCT

* *

(Pleurotus TCTGCAATTCACACTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGA

(Lentinula TTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGA

(Calocybe GATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGA

(Hypsizygus TGTGCCTATAAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGA

* * ** * * ** * * * * * * * **

(Pleurotus GATCCATTGTTGAAAGTTTTAACTGATTGCGATACAA-----------------------

(Lentinula AGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCT

(Calocybe AGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCT

(Hypsizygus AGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCT

* * * * *** * * ** *

(Pleurotus -TCAACTCAGACTTCA--------------C

(Lentinula TTGAACGCAGCTTGCACTCTATGGTTTTTCTATAGAGTACGCCTGCTTCAGTATCATCAC

(Calocybe TTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGC

(Hypsizygus TTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAA

* *** ** * *

(Pleurotus TAGATCAGACAGAGT-------TCGTGGTGTCTCCGGCGGGCGCGGGC

(Lentinula AAACCCACACATAACATTTGTTTATGTGGTGATGGGTCGCATCGCTGTTTTATTACAGT

(Calocybe TGCCCATCAAGCACGGCTTGTGTGTTGGGTCG-TCGTCCCCTCTCCGGGGGGGACGGGC

(Hypsizygus ATTCTCAAACTCACTTTGGTTTTTCCAATTGTGATGTTTGGATTGTTGGGGGCTGCTGGC

* * * * * *

(Pleurotus CCGGGGCTGAGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACA

(Lentinula GAGCACCTAAAATGTGTGTGATTTTCTGTCTGGCTTGCTAGGCAGGAATATTACGCTGGT

(Calocybe CCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCT

(Hypsizygus CTTGAC----AGGTCGGCTCCTCTTAAATGCAT-----TAGCAGGACTTCTCATTGCCT

(Pleurotus GTAAACACGGGTG------

GGAGGTTGGGCTCGCTAGGAACCCTACACTCGGTAA--

(Lentinula CTCAGGATCTTTTTTTTTGGTTCGCCCAGGAAGTAAAGTACAAGAGTATAATCCAGTAAC

(Calocybe CTGTAGGCCCGGC--------CGGCGCTT-GCCGAACGCAAATCAATCTTTTCCAGGT--

(Hypsizygus CTGCGCATGATGTGATAATTATCACTCAT-CAATAGCACGCATGAATAGAGTCCAGCT--

* * * **

(Pleurotus TGATCCTTCCGCAGGTTCACCTACGAGATCT------TTCC---

(Lentinula TTTCAAACTATGATCTGAAGTCAGGTGGGATTACCCGCTGAACTTAAGCATATCAATAAG

(Calocybe-----GACCTCGATCAGTAGTGCCAGCCCAAC------------

(Hypsizygus -------CTCTAA-TCGTCCGCAAGGACAATTGACAATTGACCTCAAATCAGTAGACAGC

* *

(Pleurotus ---G------------

(Lentinula CCGGAGGAAAATCCTT

(Calocybe ----------------

Table: 7 ITS Distance matrix

	*Lentinula edodes*	*Calocyde indica*	*Pleurotus flabellatus*	*Hypsizygus ulmarius*
Lentinula edodes	1	0.104	0.096774194	0.165217391
Calocyde indica	0.104	1	0.904761905	0.161764706
Pleurotus flabellatus	0.096774194	0.904761905	1	0.155555556
Hypsizygus ulmarius	0.165217391	0.161764706	0.155555556	1

(Hypsizygus CCGGTTAG--------

DISCUSSION:

RAPD and ITS analysis are being utilized for determining the genetic relationship between different varieties. It was proved to be highly reproducible and lot of works have been done in recent years. The RAPD analysis to detect variability amongst three different species of Trichoderma using two URP-primers and the rDNA sequence data classified Trichoderma isolates into three distinct groups representing three species. The profiles of rDNA sequences of isolates representing a species showed high similarity in T. cf. virens and T. harzianum and the variation in rDNA sequences of isolates representing T. longibrachiatum was reported. The result revealed that molecular techniques of RAPD and rDNA sequencing greatly aided in classification based on morphology and identification of species of Trichoderma⁹.

Combining RAPD data all the strains of Auricularia were differentiated and even a single primer (S10) could discriminate all tested strains. The result of genetic similarity analysis and grouping from RAPD markers disclosed a high level of genetic diversity of commercial strains of Auricularia auricula and A. polytricha. According to the result, the RAPD technique could provide a powerful tool to discriminate the commercial Auricularia strains and provide the molecular information useful for breeding systems¹⁰.

The similarity matrix that was drawn using the RAPD profiles of G. lucidum strains were compared to two other Ganoderma spp: G. applanatum and G. lipsiense to produce genetic relationship among the species. Based on the primers used, it was determined by them that the Brazilian strains and Chinese strain CC-22 are identical¹².

Among the various primers used to estimate the similarity and genetic distance among different mushroom, OPZ 10 gave the most distinguished and scorable band pattern in RAPD. It was effective on performing Cluster analysis based on frequency similarity¹³.

The allele frequency of RAPD primers was ranged from 0.71 to 1.00 whilst the polymorphic information content maximum for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 was zero, indicating medium level of polymorphism among the strains. The variability of Pleurotus strains collected from different origins was characterized at molecular level¹⁴.

Three types of ITS sequences, A, B, and C were identified with a balanced distribution differing from each other at 13 polymorphic positions. The phylogenetic comparisons with samples from different continents suggested that the type C sequence was similar to those found in Oceanian and Asian specimens of A. subrufescens where as types A and B sequences were close to American or in European type. The inheritance of these three ITS sequence among single-spore isolates from CA487 was noted by analyzing their distribution using three co-dominant markers to distinguish the homokaryotic offspring from the heterokaryotic offspring. The homokaryotic offspring were analyzed for they’re ITS types afterwards. The genetic analyses revealed that types A and B were two alleles segregating at single locus ITSI, while type C was not allelic with types A and B and it was located at another unlinked locus ITSII. It was suggested that type C was present in only one of the two constitutive haploid nuclei (n) of the heterokaryotic (n+n) parent CA487. It was concluded that the type C sequence was a relatively recent introduction and reported a duplication of the ITS locus in this strain¹⁵.

A total number of 51 samples representing seven genetic groups of the genus Pleurotus was analyzed for a phylogenetic analysis of partial sequences of the translation elongation factor 1 alpha gene (ef1a), nuc rDNA internal transcribed spacers (ITS), the RNA polymerase II largest subunit gene (rpb1) and the RNA polymerase II (rpb2). The data indicated that the mushroom Bailinggu was a lineage independent of P. eryngii and should be lifted as its own species, namely P. tuoliensis¹⁶.

Investigation on the confirmation of species identity for processed raw materials illustrated the utility of DNA barcoding to verify the taxonomic identity of fungi found frequently in the food and dietary supplement industry. The use of DNA barcoding of nuclear ribosomal internal transcribed spacer (ITS) of the rRNA gene with fungal specific ITS primers generated ITS barcodes for 33 representative fungal samples. The ITS region was sequenced from powdered mycelium samples, grocery store mushrooms, and capsules from commercial dietary supplements. After generating ITS barcodes they were tested for the utility by performing BLAST search against authenticate published ITS sequences in GenBank. The homologous sequences of the ITS region of fungi inspected in the study was used to examine the phylogenetic relationships of barcoded fungal species in light of modern taxonomic and phylogenetic studies. It was opined these data on DNA barcoding based species identification could be applied for the identification of mushroom¹⁷.

In our study RAPD revealed to be very efficient to draw the genetic distances. The binding ability of primer to DNA varied the among 18 primer pairs used. Banding pattern and number of bands varied amongst the varieties also showed different pattern. A total of 294 fragments were amplified among which OPR 09 was proved to be the best primer producing maximum number of unique amplified products in all the four varieties. RAPD finger printing produced a very good molecular marking. Out of 18 primer polymorphic bands originated that showed positive DNA marking pattern.

The proximity matrix and phylogenetic tree proved their relationship. It formed three main clusters. The first cluster was again subdivided into two subclusters. Pleurotus represented one and Calocybe represented the other. Lentinula and Hypsizygus represented the other two main clusters separately. From this data it could be conjectured that Pleurotus and Calocybe were closely related whereas Lentinula and Hypsizygus were distantly related to each other in an evolutionary tree.

In the present study ITS sequence was also proved to be very efficient in determining the relationship among these four varieties under study. The homology of the ITS sequences as reveled by BLAST analysis showed a huge similarity among the ITS sequences of other mushrooms present in the database. The ClustalW analysis among these varieties proved the presence of conserved sequences in the ITS region. When the distance matrix was created using ITS sequences the value was 1.000 amongst all varieties.

ITS1 and ITS2 sequence analysis provided a little different interesting phylogenic tree. The sequence analysis reveals that Calocybe to close to Hypsizygus and both originated from a single node and form monophyletic group. Calocybe, Hypsizygus and Lentinula have originated from a common ancestor group. Whereas Lentinula and Pleurotus originated from different node forming paraphyletic group. ITS represents more informative and informational study as it is based on DNA sequencing analysis and the similarity related to the origin and phylogenetic relationship amongst Genus.

REFERENCES:

1. Khatua S., Paul S., Acharya K. Mushroom as the Potential Source of New Generation of Antioxidant: A Review. Research J. Pharm. and Tech. 2013; 6 (5): 496-505.

2. Murthykumar K. The Impact of mushroom, chicory extracts, fresh fruits, xylitol containing chewing gums and milk products on dental caries-A Review. Research J. Pharm. and Tech. 2014; 7(2): 266-268.

3. Bose S., Mandal S.K., Hossain P., Das A., Das P., Nandy S., Giri S.K., Chakraborti C.K. Phytochemical and Pharmacological Potentials of Agaricus bisporus. Research J. Pharm. and Tech. 2019; 12 (8): 3811-3817.

4. Chandrashekar A., Muralidharan A., Koteshwara A., Alex A.T., Subrahmanyam V.M. Isolation and Characterization of an actinomycete strain producing an antifungal metabolite effective against Candida albicans. Research J. Pharm. and Tech. 2019; 12(10):4601-4606.

5. Kermasha H.S.N.. Effect of Fermentation Oyster Mushrooms (Pleurotus ostreatus) on Grain Barly contaminated with Fungus exudate toxins Fusarium sporotrichioides and the inhibition growth and Degradation Toxins produced by it. Research J. Pharm. and Tech. 2019; 12(12): 5677-5682. doi: 10.5958/0974-360X.2019.00982.X

6. Kamalambigeswari R., Sharmila S., Kowsalya E., Janani S.S., Deva V., Rebecca L.J. Extraction of Omega-3 Fatty Acid -methyl stearate from Soil Fungi (Fusarium sp.). Research J. Pharm. and Tech 2019; 12(9):4295-4298.

7. Bansal V., Tyagi S., Ghosh K., Gupta A. Extraction of protein from Mushroom and determining its Antioxidant and Anti-Inflammatory Potential. Research J. Pharm. and Tech. 2020; 13(12):6017-6021. doi: 10.5958/0974-360X.2020.01049.5

8. Karnwal A., Dohroo A., Sharma S. Analysing the Biocontrol Attribute of Indigenous Mushroom concentrates against Pathogenic bacterial spp. Research J. Pharm. and Tech. 2020; 13 (1) :173-177. doi: 10.5958/0974-360X.2020.00035.9

9. Choi IY., Hong S.B., and Yadav M.C. Molecular and morphological characterization of green mold, Trichoderma spp. isolated from oyster mushrooms. Mycobiology. 2003; 31.2: 74-80.

10. Yan PS, Luo XC, Zhou Q. RAPD molecular differentiation of the cultivated strains of the jelly mushrooms, Auricularia auricula and A. polytricha. World Journal of Microbiology and Biotechnology. 2004;20(8):795-9.

11. Shukla K., Shukla S.S., Jain V., Pandey R., Jain S., Saraf S., Saraf S. Fingerprinting of Traditional Medicines through RAPD Technology: - A Newer Approach. Research J. Pharm. and Tech. 2008; 1(2); 63-68.

12. Rolim LD, Cavalcante MA, Urben AF, Buso GS. Use of RAPD molecular markers on differentiation of Brazilian and Chinese Ganoderma lucidum strains. Brazilian Archives of Biology and Technology. 2011; 54(2):273-81.

13. Agarwal K., Prasad M. P., and Rindhe G. Genomic discrimination of eleven commercial mushrooms by DNA fingerprinting using RAPD marker. Int Res J Biol Sci 2.10 (2013): 1-5.

14. Khan N.A., Binyamin R., Awan F.S., Khan A,I., Waseem M.U. Genetic diversity of edible mushroom Pleurotus spp. revealed by randomly amplified polymorphic DNA fingerprinting. Pak. J. Bot. 2017 ; 49 (4) :1517-21.

15. Chen J., Moinard M., Xu J., Wang S., Foulongne-Oriol M., Zhao R., Hyde K.D., Callac P. Genetic analyses of the internal transcribed spacer sequences suggest introgression and duplication in the medicinal mushroom Agaricus subrufescens. PLoS One. 2016; 26; 11 (5).

16. Zhao M., Zhang J., Chen Q., Wu X., Gao .W, Deng W., Huang C. The famous cultivated mushroom Bailinggu is a separate species of the Pleurotus eryngii species complex. Scientific Reports. 2016; 6 (1):1-9.

17. Raja H.A., Baker T.R., Little J.G., Oberlies N.H. DNA barcoding for identification of consumer-relevant mushrooms: A partial solution for product certification?. Food Chemistry. 2017; 214 : 383-92.

18. Rukmana S., Ansori A.N.M., Kusala M.K.J., Utami U., Wahyudi D., Mandasari A.A. Molecular Identification of Trichoderma Isolates from Sugarcane Bagasse Based on Internal Transcribed Spacer (ITS) rDNA. Research J. Pharm. and Tech. 2020; 13(7): 3300-3304. doi: 10.5958/0974-360X.2020.00585.5.

19. Sun Y., Skinner D.Z., Liang G.H., Hulbert S.H. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics. 1994; 89 (1) :26-32.

20. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research. 1997 Sep 1 ; 25(17):3389-402.

Received on 19.05.2021 Modified on 27.06.2021

Research J. Pharm. and Tech. 2022; 15(5):2208-2215.

DOI: 10.52711/0974-360X.2022.00367